Lab Reagents
Human IgG antibody Laboratories manufactures the rnh1 antibody xenopus reagents distributed by Genprice. The Rnh1 Antibody Xenopus reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact xenopus Antibody. Other Rnh1 products are available in stock. Specificity: Rnh1 Category: Antibody Group: Xenopus
Xenopus information
Xenopus SUMO2 Antibody |
abx027062-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
RNH1 Conjugated Antibody |
C40076 |
SAB |
100ul |
EUR 397 |
anti- RNH1 antibody |
FNab07365 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: ribonuclease/angiogenin inhibitor 1
- Uniprot ID: P13489
- Gene ID: 6050
- Research Area: Cardiovascular,
|
Description: Antibody raised against RNH1 |
anti- RNH1 antibody |
FNab07366 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:4000
- Immunogen: ribonuclease/angiogenin inhibitor 1
- Uniprot ID: P13489
- Gene ID: 6050
- Research Area: Cardiovascular
|
Description: Antibody raised against RNH1 |
RNH1 siRNA |
20-abx904624 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNH1 siRNA |
20-abx931816 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNH1 siRNA |
20-abx931817 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNH1 Blocking Peptide |
33R-5147 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNH1 antibody, catalog no. 70R-2761 |
RNH1 Blocking Peptide |
33R-7876 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNH1 antibody, catalog no. 70R-3019 |
RNH1 Blocking Peptide |
DF12170-BP |
Affbiotech |
1mg |
EUR 195 |
RNH1 cloning plasmid |
CSB-CL019901HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1386
- Sequence: atgagcctggacatccagagcctggacatccagtgtgaggagctgagcgacgctagatgggccgagctcctccctctgctccagcagtgccaagtggtcaggctggacgactgtggcctcacggaagcacggtgcaaggacatcagctctgcacttcgagtcaaccctgcactgg
- Show more
|
Description: A cloning plasmid for the RNH1 gene. |
RNH1 cloning plasmid |
CSB-CL019901HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1386
- Sequence: atgagcctggacatccagagcctggacatccagtgtgaggagctgagcgacgctagatgggccgagctcctccctctgctccagcagtgccaagtggtcaggctggacgactgtggcctcacggaagcacggtgcaaggacatcagctctgcacttcgagtcaaccctgcactgg
- Show more
|
Description: A cloning plasmid for the RNH1 gene. |
RNH1 Rabbit pAb |
A4079-100ul |
Abclonal |
100 ul |
EUR 308 |