Rnh1 Antibody Xenopus

Lab Reagents

Human IgG antibody Laboratories manufactures the rnh1 antibody xenopus reagents distributed by Genprice. The Rnh1 Antibody Xenopus reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact xenopus Antibody. Other Rnh1 products are available in stock. Specificity: Rnh1 Category: Antibody Group: Xenopus

Xenopus information

Xenopus SUMO2 Antibody
abx027062-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Rnh1/ Rat Rnh1 ELISA Kit
ELI-04720r	Lifescience Market	96 Tests	EUR 886

RNH1 Conjugated Antibody
C40076	SAB	100ul	EUR 397

anti- RNH1 antibody
FNab07365	FN Test	100µg	EUR 548.75
Immunogen: ribonuclease/angiogenin inhibitor 1 Uniprot ID: P13489 Gene ID: 6050 Research Area: Cardiovascular,
Description: Antibody raised against RNH1

anti- RNH1 antibody
FNab07366	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:4000 Immunogen: ribonuclease/angiogenin inhibitor 1 Uniprot ID: P13489 Gene ID: 6050 Research Area: Cardiovascular
Description: Antibody raised against RNH1

Anti-RNH1 antibody
PAab07365	Lifescience Market	100 ug	EUR 386

Anti-RNH1 antibody
STJ25374	St John's Laboratory	100 µl	EUR 277

RNH1 siRNA
20-abx904624	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNH1 siRNA
20-abx931816	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNH1 siRNA
20-abx931817	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-RNH1
PVT18933	Lifescience Market	2 ug	EUR 231

RNH1 Blocking Peptide
33R-5147	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNH1 antibody, catalog no. 70R-2761

RNH1 Blocking Peptide
33R-7876	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNH1 antibody, catalog no. 70R-3019

RNH1 Blocking Peptide
DF12170-BP	Affbiotech	1mg	EUR 195

RNH1 cloning plasmid
CSB-CL019901HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1386 Sequence: atgagcctggacatccagagcctggacatccagtgtgaggagctgagcgacgctagatgggccgagctcctccctctgctccagcagtgccaagtggtcaggctggacgactgtggcctcacggaagcacggtgcaaggacatcagctctgcacttcgagtcaaccctgcactgg Show more
Description: A cloning plasmid for the RNH1 gene.

RNH1 cloning plasmid
CSB-CL019901HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1386 Sequence: atgagcctggacatccagagcctggacatccagtgtgaggagctgagcgacgctagatgggccgagctcctccctctgctccagcagtgccaagtggtcaggctggacgactgtggcctcacggaagcacggtgcaaggacatcagctctgcacttcgagtcaaccctgcactgg Show more
Description: A cloning plasmid for the RNH1 gene.

RNH1 Rabbit pAb
A4079-100ul	Abclonal	100 ul	EUR 308