June 13, 2021

Rnh1 Antibody Xenopus

Lab Reagents

Human IgG antibody Laboratories manufactures the rnh1 antibody xenopus reagents distributed by Genprice. The Rnh1 Antibody Xenopus reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact xenopus Antibody. Other Rnh1 products are available in stock. Specificity: Rnh1 Category: Antibody Group: Xenopus

Xenopus information

Xenopus SUMO2 Antibody

abx027062-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rnh1/ Rat Rnh1 ELISA Kit

ELI-04720r 96 Tests
EUR 886

RNH1 Conjugated Antibody

C40076 100ul
EUR 397

anti- RNH1 antibody

FNab07365 100µg
EUR 548.75
  • Immunogen: ribonuclease/angiogenin inhibitor 1
  • Uniprot ID: P13489
  • Gene ID: 6050
  • Research Area: Cardiovascular,
Description: Antibody raised against RNH1

anti- RNH1 antibody

FNab07366 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:4000
  • Immunogen: ribonuclease/angiogenin inhibitor 1
  • Uniprot ID: P13489
  • Gene ID: 6050
  • Research Area: Cardiovascular
Description: Antibody raised against RNH1

Anti-RNH1 antibody

PAab07365 100 ug
EUR 386

Anti-RNH1 antibody

STJ25374 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18933 2 ug
EUR 231

RNH1 Blocking Peptide

33R-5147 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNH1 antibody, catalog no. 70R-2761

RNH1 Blocking Peptide

33R-7876 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNH1 antibody, catalog no. 70R-3019

RNH1 Blocking Peptide

DF12170-BP 1mg
EUR 195

RNH1 cloning plasmid

CSB-CL019901HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1386
  • Sequence: atgagcctggacatccagagcctggacatccagtgtgaggagctgagcgacgctagatgggccgagctcctccctctgctccagcagtgccaagtggtcaggctggacgactgtggcctcacggaagcacggtgcaaggacatcagctctgcacttcgagtcaaccctgcactgg
  • Show more
Description: A cloning plasmid for the RNH1 gene.

RNH1 cloning plasmid

CSB-CL019901HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1386
  • Sequence: atgagcctggacatccagagcctggacatccagtgtgaggagctgagcgacgctagatgggccgagctcctccctctgctccagcagtgccaagtggtcaggctggacgactgtggcctcacggaagcacggtgcaaggacatcagctctgcacttcgagtcaaccctgcactgg
  • Show more
Description: A cloning plasmid for the RNH1 gene.

RNH1 Rabbit pAb

A4079-100ul 100 ul
EUR 308