|
70R-31924 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ZFHX3 antibody |
Fitzgerald Antibodies Laboratories manufactures the fitzgerald antibody zfhx3 reagents distributed by Genprice. The Fitzgerald Antibody Zfhx3 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Fitzgerald Antibodies. Other Fitzgerald products are available in stock. Specificity: Fitzgerald Category: Antibody Group: Zfhx3
Zfhx3 information
ZFHX3 cloning plasmid |
CSB-CL619002HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2661
- Sequence: atgcggctcgggggcgggcagctggtgtcagaggagctgatgaacctgggcgagagcttcatccagaccaacgacccgtcgctgaagctcttccagtgcgccgtctgcaacaagttcacgacggacaacctggacatgctgggcctgcacatgaacgtggagcgcagcctgtcgg
- Show more
|
Description: A cloning plasmid for the ZFHX3 gene. |
Human ZFHX3 shRNA Plasmid |
20-abx950323 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal ZFHX3 / ATBF1 Antibody (aa517-787) |
APR14024G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZFHX3 / ATBF1 (aa517-787). This antibody is tested and proven to work in the following applications: |
Zfhx3 ORF Vector (Mouse) (pORF) |
ORF062195 |
ABM |
1.0 ug DNA |
EUR 4018 |
ZFHX3 ORF Vector (Human) (pORF) |
ORF011791 |
ABM |
1.0 ug DNA |
EUR 95 |
ZFHX3 ELISA Kit (Mouse) (OKEH05712) |
OKEH05712 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Transcriptional regulator which can act as an activator or a repressor. Inhibits the enhancer element of the AFP gene by binding to its AT-rich core sequence. In concert with SMAD-dependent TGF-beta signaling can repress the transcription of AFP via its interaction with SMAD2/3. Regulates the circadian locomotor rhythms via transcriptional activation of neuropeptidergic genes which are essential for intercellular synchrony and rhythm amplitude in the suprachiasmatic nucleus (SCN) of the brain.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL |
ZFHX3 ELISA Kit (Human) (OKEH04430) |
OKEH04430 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL |
Zinc Finger Homeobox Protein 3 (ZFHX3) Antibody |
abx036703-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Zinc Finger Homeobox Protein 3 (ZFHX3) Antibody |
20-abx013635 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Zinc finger homeobox protein 3 (ZFHX3) Antibody |
abx331397-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Zinc finger homeobox protein 3 (ZFHX3) Antibody |
20-abx325157 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZFHX3 sgRNA CRISPR Lentivector set (Human) |
K2672401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zfhx3 sgRNA CRISPR Lentivector set (Mouse) |
K3939101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ZFHX3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2672402 |
ABM |
1.0 ug DNA |
EUR 154 |
ZFHX3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2672403 |
ABM |
1.0 ug DNA |
EUR 154 |