April 12, 2021

Fitzgerald Antibody Zfhx3

ZFHX3 antibody

70R-31924 100 ug
EUR 327
Description: Rabbit polyclonal ZFHX3 antibody

Fitzgerald Antibodies Laboratories manufactures the fitzgerald antibody zfhx3 reagents distributed by Genprice. The Fitzgerald Antibody Zfhx3 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Fitzgerald Antibodies. Other Fitzgerald products are available in stock. Specificity: Fitzgerald Category: Antibody Group: Zfhx3

Zfhx3 information

ZFHX3 cloning plasmid

CSB-CL619002HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2661
  • Sequence: atgcggctcgggggcgggcagctggtgtcagaggagctgatgaacctgggcgagagcttcatccagaccaacgacccgtcgctgaagctcttccagtgcgccgtctgcaacaagttcacgacggacaacctggacatgctgggcctgcacatgaacgtggagcgcagcctgtcgg
  • Show more
Description: A cloning plasmid for the ZFHX3 gene.

Human ZFHX3 ELISA Kit

ELA-E1065h 96 Tests
EUR 824

ZFHX3 ELISA KIT|Human

EF002669 96 Tests
EUR 689

Human ZFHX3 shRNA Plasmid

20-abx950323
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal ZFHX3 / ATBF1 Antibody (aa517-787)

APR14024G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZFHX3 / ATBF1 (aa517-787). This antibody is tested and proven to work in the following applications:

Zfhx3 ORF Vector (Mouse) (pORF)

ORF062195 1.0 ug DNA
EUR 4018

ZFHX3 ORF Vector (Human) (pORF)

ORF011791 1.0 ug DNA
EUR 95

ZFHX3 ELISA Kit (Mouse) (OKEH05712)

OKEH05712 96 Wells
EUR 662
Description: Description of target: Transcriptional regulator which can act as an activator or a repressor. Inhibits the enhancer element of the AFP gene by binding to its AT-rich core sequence. In concert with SMAD-dependent TGF-beta signaling can repress the transcription of AFP via its interaction with SMAD2/3. Regulates the circadian locomotor rhythms via transcriptional activation of neuropeptidergic genes which are essential for intercellular synchrony and rhythm amplitude in the suprachiasmatic nucleus (SCN) of the brain.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL

ZFHX3 ELISA Kit (Human) (OKEH04430)

OKEH04430 96 Wells
EUR 662
Description: Description of target: This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL

Zinc Finger Homeobox Protein 3 (ZFHX3) Antibody

abx036703-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger Homeobox Protein 3 (ZFHX3) Antibody

20-abx013635
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Zinc finger homeobox protein 3 (ZFHX3) Antibody

abx331397-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Zinc finger homeobox protein 3 (ZFHX3) Antibody

20-abx325157
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZFHX3 sgRNA CRISPR Lentivector set (Human)

K2672401 3 x 1.0 ug
EUR 339

Zfhx3 sgRNA CRISPR Lentivector set (Mouse)

K3939101 3 x 1.0 ug
EUR 339

ZFHX3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2672402 1.0 ug DNA
EUR 154

ZFHX3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2672403 1.0 ug DNA
EUR 154