Lab Reagents
Human IgG antibody Laboratories manufactures the histosol bodenklassifikation wrb beispiel reagents distributed by Genprice. The Histosol Bodenklassifikation Wrb Beispiel reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact National Diagnostics. Other Histosol products are available in stock. Specificity: Histosol Category: Bodenklassifikation Group: Wrb Beispiel
Wrb Beispiel information
WRB cloning plasmid |
CSB-CL026148HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 525
- Sequence: atgagctcagccgcggccgaccactgggcgtggttgctggtgctcagcttcgtgtttggatgcaatgttcttaggatcctcctcccgtccttctcatccttcatgtccagggtgctgcagaaggacgcggagcaggagtcacagatgagagcggagatccaggacatgaagcagga
- Show more
|
Description: A cloning plasmid for the WRB gene. |
WRB Rabbit pAb |
A7000-100ul |
Abclonal |
100 ul |
EUR 308 |
WRB Rabbit pAb |
A7000-200ul |
Abclonal |
200 ul |
EUR 459 |
WRB Rabbit pAb |
A7000-20ul |
Abclonal |
20 ul |
EUR 183 |
WRB Rabbit pAb |
A7000-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-WRB antibody |
STJ29080 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a basic nuclear protein of unknown function. The gene is widely expressed in adult and fetal tissues. Since the region proposed to contain the gene(s) for congenital heart disease (CHD) in Down syndrome (DS) patients has been restricted to 21q22.2-22.3, this gene, which maps to 21q22.3, has a potential role in the pathogenesis of Down syndrome congenital heart disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (HRP) |
20-abx313187 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (FITC) |
20-abx313188 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (Biotin) |
20-abx313189 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
WRB Antibody, HRP conjugated |
1-CSB-PA026148LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
WRB Antibody, FITC conjugated |
1-CSB-PA026148LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
WRB Antibody, Biotin conjugated |
1-CSB-PA026148LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rat WRB shRNA Plasmid |
20-abx988309 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse WRB shRNA Plasmid |
20-abx977415 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
WRB Polyclonal Conjugated Antibody |
C30787 |
SAB |
100ul |
EUR 397 |
Human WRB shRNA Plasmid |
20-abx955124 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|