Histosol Bodenklassifikation Wrb Beispiel

Lab Reagents

Human IgG antibody Laboratories manufactures the histosol bodenklassifikation wrb beispiel reagents distributed by Genprice. The Histosol Bodenklassifikation Wrb Beispiel reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact National Diagnostics. Other Histosol products are available in stock. Specificity: Histosol Category: Bodenklassifikation Group: Wrb Beispiel

Wrb Beispiel information

WRB cloning plasmid
CSB-CL026148HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 525 Sequence: atgagctcagccgcggccgaccactgggcgtggttgctggtgctcagcttcgtgtttggatgcaatgttcttaggatcctcctcccgtccttctcatccttcatgtccagggtgctgcagaaggacgcggagcaggagtcacagatgagagcggagatccaggacatgaagcagga Show more
Description: A cloning plasmid for the WRB gene.

WRB Rabbit pAb
A7000-100ul	Abclonal	100 ul	EUR 308

WRB Rabbit pAb
A7000-200ul	Abclonal	200 ul	EUR 459

WRB Rabbit pAb
A7000-20ul	Abclonal	20 ul	EUR 183

WRB Rabbit pAb
A7000-50ul	Abclonal	50 ul	EUR 223

pCMV-SPORT6-WRB
PVT13536	Lifescience Market	2 ug	EUR 391

Anti-WRB antibody
STJ29080	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a basic nuclear protein of unknown function. The gene is widely expressed in adult and fetal tissues. Since the region proposed to contain the gene(s) for congenital heart disease (CHD) in Down syndrome (DS) patients has been restricted to 21q22.2-22.3, this gene, which maps to 21q22.3, has a potential role in the pathogenesis of Down syndrome congenital heart disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (HRP)
20-abx313187	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (FITC)
20-abx313188	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (Biotin)
20-abx313189	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

WRB Antibody, HRP conjugated
1-CSB-PA026148LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WRB Antibody, FITC conjugated
1-CSB-PA026148LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

WRB Antibody, Biotin conjugated
1-CSB-PA026148LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat WRB shRNA Plasmid
20-abx988309	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse WRB shRNA Plasmid
20-abx977415	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

WRB Polyclonal Conjugated Antibody
C30787	SAB	100ul	EUR 397

Human WRB shRNA Plasmid
20-abx955124	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.