April 12, 2021

Histosol Bodenklassifikation Wrb Beispiel

Lab Reagents

Human IgG antibody Laboratories manufactures the histosol bodenklassifikation wrb beispiel reagents distributed by Genprice. The Histosol Bodenklassifikation Wrb Beispiel reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact National Diagnostics. Other Histosol products are available in stock. Specificity: Histosol Category: Bodenklassifikation Group: Wrb Beispiel

Wrb Beispiel information

WRB cloning plasmid

CSB-CL026148HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: atgagctcagccgcggccgaccactgggcgtggttgctggtgctcagcttcgtgtttggatgcaatgttcttaggatcctcctcccgtccttctcatccttcatgtccagggtgctgcagaaggacgcggagcaggagtcacagatgagagcggagatccaggacatgaagcagga
  • Show more
Description: A cloning plasmid for the WRB gene.

WRB Rabbit pAb

A7000-100ul 100 ul
EUR 308

WRB Rabbit pAb

A7000-200ul 200 ul
EUR 459

WRB Rabbit pAb

A7000-20ul 20 ul
EUR 183

WRB Rabbit pAb

A7000-50ul 50 ul
EUR 223


PVT13536 2 ug
EUR 391

Anti-WRB antibody

STJ29080 100 µl
EUR 277
Description: This gene encodes a basic nuclear protein of unknown function. The gene is widely expressed in adult and fetal tissues. Since the region proposed to contain the gene(s) for congenital heart disease (CHD) in Down syndrome (DS) patients has been restricted to 21q22.2-22.3, this gene, which maps to 21q22.3, has a potential role in the pathogenesis of Down syndrome congenital heart disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tail-Anchored Protein Insertion Receptor WRB (WRB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WRB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WRB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

WRB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WRB. Recognizes WRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat WRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse WRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WRB Polyclonal Conjugated Antibody

C30787 100ul
EUR 397

Human WRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.